Search result

BaseInfo

ncRNA ID	ath-miR5654-3p
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr1:11786292-11786371 [+]
Reference genome	TAIR10
Source	miRBase
Length	23
Mature sequence(if miRNA)	57 - UGGAAGAUGCUUUGGGAUUUAUU - 79
Stem-loop(if miRNA)	--         CC   C    CU GAA AAAUAAAUCCCAA  CAUCUUCCA  UUA CGGC  U   C |||||||||||||  |||||||||  ||| ||||  | UUUAUUUAGGGUU  GUAGAAGGU  AAU GUCG  A   A              UC         AA   U    AU GUU
Stem-loop sequence	AAAUAAAUCCCAACAUCUUCCACCUUACCGGCCUUGAACAUUGAUAGCUGUUAAAAUGGAAGAUGCUUUGGGAUUUAUUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001340904.1	ncRNA:23   UUAUUUAGGGUUUCGUAGAAGGU   1   |*||||||*=||||||||||||| targets:12   AUUAAAUCAUAAAGCAUCUUCCA   34 Target Full Sequence	2.0	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT4G14170)	coding protein	psRNATarget
NM_117494.4	ncRNA:23   UUAUUUAGGGUUUCGUAGAAGGU   1   |*||||||*=||||||||||||| targets:8   AUUAAAUCAUAAAGCAUCUUCCA   30 Target Full Sequence	2.0	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT4G14170)	coding protein	psRNATarget

Reference

1	PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis"; Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN; Genome Res. 22:163-176(2012).
2	PMID:22221297 "Global analysis of non-coding small RNAs in Arabidopsis in response to jasmonate treatment by deep sequencing technology"; Zhang B, Xie D, Jin Z; J Integr Plant Biol. 54:73-86(2012).