ncRNA ID | ath-miR5654-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:11786292-11786371 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 3 - AUAAAUCCCAACAUCUUCCA - 22 |
Stem-loop(if miRNA) |
             --         CC   C    CU GAA AAAUAAAUCCCAA  CAUCUUCCA  UUA CGGC  U   C |||||||||||||  |||||||||  ||| ||||  | UUUAUUUAGGGUU  GUAGAAGGU  AAU GUCG  A   A              UC         AA   U    AU GUU |
Stem-loop sequence | AAAUAAAUCCCAACAUCUUCCACCUUACCGGCCUUGAACAUUGAUAGCUGUUAAAAUGGAAGAUGCUUUGGGAUUUAUUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BT008757.1 |
|
2.5 | Arabidopsis thaliana At1g52770 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX813568.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB24ZG10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
BT002492.1 |
|
2.5 | Arabidopsis thaliana putative non-phototropic hypocotyl (At1g52770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_104155.4 |
|
2.5 | Arabidopsis thaliana Phototropic-responsive NPH3 family protein mRNA | Phototropic-responsive NPH3 family protein(AT1G52770) | coding protein | psRNATarget |
1 | PMID:21940835
"High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis"; Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN; Genome Res. 22:163-176(2012). |
2 | PMID:22221297
"Global analysis of non-coding small RNAs in Arabidopsis in response to jasmonate treatment by deep sequencing technology"; Zhang B, Xie D, Jin Z; J Integr Plant Biol. 54:73-86(2012). |