Search result

BaseInfo

ncRNA ID	ath-miRf10241-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - UCGUGGCCGAUCUGCUGAGG - NA
Stem-loop(if miRNA)	GU   AG      CCA      U   G AUC     -A    GAG   UAAAGGCGUCAA GGUG  UGC  UAGUAG   CGGCCA CGA C   GUCGC  AUGA   GAC            U ||||  |||  ||||||   |||||| ||| |   |||||  ||||   ||| UCAC  AUG  GUCGUC   GCCGGU GCU G   CAGCG  UACU   ACU            G     UC   GA      -UA      -   - --C     CC    ---   AGAACAGUUCUG
Stem-loop sequence	GGUGGUUGCAGUAGUAGCCACGGCCAUCGAGCAUCGUCGCAAUGAGAGGACUAAAGGCGUCAAUGGUCUUGACAAGAUCAUCAUCCGCGACCGUCGUGGCCGAUCUGCUGAGGUACUCACU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT006372.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:133   CCUAAGCACAUCGGCCACGA   152 Target Full Sequence	2.5	Arabidopsis thaliana At3g08610 gene, complete cds	NA	coding protein	psRNATarget
BX824861.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:91   CCUAAGCACAUCGGCCACGA   110 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH78ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX826101.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:120   CCUAAGCACAUCGGCCACGA   139 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL84ZF11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX826224.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:120   CCUAAGCACAUCGGCCACGA   139 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL92ZD07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX825594.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:115   CCUAAGCACAUCGGCCACGA   134 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY088759.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:137   CCUAAGCACAUCGGCCACGA   156 Target Full Sequence	2.5	Arabidopsis thaliana clone 9458 mRNA, complete sequence	NA	coding protein	psRNATarget
BX826057.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:128   CCUAAGCACAUCGGCCACGA   147 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL81ZH07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX823188.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:144   CCUAAGCACAUCGGCCACGA   163 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB9ZB04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK227324.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:134   CCUAAGCACAUCGGCCACGA   153 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL14-01-P22	NA	coding protein	psRNATarget
BX825349.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:148   CCUAAGCACAUCGGCCACGA   167 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL31ZD02 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK220620.1	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:157   CCUAAGCACAUCGGCCACGA   176 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL19-91-I22	NA	coding protein	psRNATarget
NM_111695.3	ncRNA:20   GGAGUCGUCUAGCCGGUGCU   1   |||*||||*||||||||||| targets:275   CCUAAGCACAUCGGCCACGA   294 Target Full Sequence	2.5	Arabidopsis thaliana NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit mRNA	NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit(AT3G08610)	coding protein	psRNATarget