ncRNA ID | ath-miR404 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:11230463-11230612 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 112 - AUUAACGCUGGCGGUUGCGGCAGC - 135 |
Stem-loop(if miRNA) |
UAGCA  -UU  UUU  UUAAC   G                           GUG       A  CU  -C    G      UG   CG   CA     GCU GCGGUUGCGGCAGCGGCUGCGGUAGCG   GCGGCAA CA  AC  GCAG U      ||   ||   ||     ||| |||||||||||||||||||||||||||   ||||||| ||  ||  ||||      GC   GC   GU     UGG CGCCAACGCCGUCGCCGACGCCGUCGC   CGCCGUU GU  UG  UGUU U --GCA  UUU  -UU  UUCUU   A                           AGA       -  UU  CU    G |
Stem-loop sequence | UAGCAUGUUCGUUUCAUUAACGCUGGCGGUUGCGGCAGCGGCUGCGGUAGCGGUGGCGGCAAACACUACCGCAGGUUGUUGUUCGUUUUGUUGCCGCAGACGCUGCCGCAGCCGCUGCCGCAACCGCAGGUUUCUUUGUUCGUUUCGACG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AK220830.1 |
|
1.5 | Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-35-J12 | NA | coding protein | psRNATarget | |||||||||
NM_001331714.1 |
|
1.5 | Arabidopsis thaliana Leucine-rich repeat transmembrane protein kinase mRNA | Leucine-rich repeat transmembrane protein kinase(AT1G07650) | coding protein | psRNATarget | |||||||||
NM_001198001.2 |
|
1.5 | Arabidopsis thaliana Leucine-rich repeat transmembrane protein kinase mRNA | Leucine-rich repeat transmembrane protein kinase(AT1G07650) | coding protein | psRNATarget | |||||||||
NM_100638.5 |
|
1.5 | Arabidopsis thaliana Leucine-rich repeat transmembrane protein kinase mRNA | Leucine-rich repeat transmembrane protein kinase(AT1G07650) | coding protein | psRNATarget |
1 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
2 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |