Search result

BaseInfo

ncRNA ID	ath-miRf10185-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - GCGUUGGUGACCAGCCUCUG - NA
Stem-loop(if miRNA)	U   UG         --A       A G   -   -  GGUCUUGUAUUUAGCUGCGUAUUCUGGUCCAACAAUGUCUGAGUAGU  UUC  CAGAGGCUG   GCCAGCG G UAA AUC AA                                               A  |||  |||||||||   ||||||| | ||| ||| ||  AAG  GUCUCCGAC   UGGUUGC A AGA CCA UG                                               U A   UG         CAG       G -   A   A  UCACGGGUUCCUCGAAAAUUUAUGCCAGAGAUACUCAUGCGGUUCUU
Stem-loop sequence	UUUCUGCAGAGGCUGAGCCAGCGAGGUAAAUCAAGGUCUUGUAUUUAGCUGCGUAUUCUGGUCCAACAAUGUCUGAGUAGUAUUUCUUGGCGUACUCAUAGAGACCGUAUUUAAAAGCUCCUUGGGCACUGUAACCAAGAAGCGUUGGUGACCAGCCUCUGGUGAAA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT033111.1	ncRNA:20   GUCUCCGACCAGUGGUUGCG   1   |||||||||||||||||||| targets:366   CAGAGGCUGGUCACCAACGC   385 Target Full Sequence	0.0	Arabidopsis thaliana unknown protein (At3g48850) mRNA, complete cds	NA	coding protein	psRNATarget
BX824852.1	ncRNA:20   GUCUCCGACCAGUGGUUGCG   1   |||||||||||||||||||| targets:434   CAGAGGCUGGUCACCAACGC   453 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH77ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX822433.1	ncRNA:20   GUCUCCGACCAGUGGUUGCG   1   |||||||||||||||||||| targets:419   CAGAGGCUGGUCACCAACGC   438 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB38ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_114744.4	ncRNA:20   GUCUCCGACCAGUGGUUGCG   1   |||||||||||||||||||| targets:515   CAGAGGCUGGUCACCAACGC   534 Target Full Sequence	0.0	Arabidopsis thaliana phosphate transporter 3;2 (PHT3;2), mRNA	phosphate transporter 3;2(PHT3;2)	coding protein	psRNATarget
BX822862.1	ncRNA:20   GUCUCCGACCAGUGGUUGCG   1   ||||*||||||||||||||| targets:435   CAGAAGCUGGUCACCAACGC   454 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB69ZF07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX824227.1	ncRNA:20   GUCUCCGACCAGUGGUUGCG   1   ||||||||||||||||||*| targets:428   CAGAGGCUGGUCACCAACUC   447 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH31ZB01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_102424.3	ncRNA:20   GUCUCCGACCAGUGGUUGCG   1   ||**|||||||||||||||| targets:2306   CAAUGGCUGGUCACCAACGC   2325 Target Full Sequence	2.0	Arabidopsis thaliana T-box transcription factor, putative (DUF863) mRNA	T-box transcription factor, putative (DUF863)(AT1G26620)	coding protein	psRNATarget