ncRNA ID | ath-miR399a |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:10227073-10227195 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 93 - UGCCAAAGGAGAUUUGCCCUG - 113 |
Stem-loop(if miRNA) |
AAAU C           A       A        A   -     C     -U UU     CU     G AUUACAGGGUA GAUCUCU UUGGCAGG AAC CAUUA UUAGA  C  UGCAU  C     | ||||||||||| ||||||| |||||||| ||| ||||| |||||  |  |||||     C UAAUGUCCCGU UUAGAGG AACCGUCU UUG GUGAU AAUUU  G  ACGUA  U UCUU U           -       A        A   A     U     UC UU     UU |
Stem-loop sequence | AAAUGCAUUACAGGGUAAGAUCUCUAUUGGCAGGAAACCAUUACUUAGAUCUUUGCAUCUCUUUAUGCAUUGCUUUUAAUUAGUGAGUUAUCUGCCAAAGGAGAUUUGCCCUGUAAUUCUUCU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AY074292.1 |
|
0.0 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
0.0 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
AY074292.1 |
|
1.0 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY074292.1 |
|
1.0 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY074292.1 |
|
1.0 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
1.0 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
1.0 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
1.0 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
AY074292.1 |
|
1.5 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
1.5 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
NM_001338199.1 |
|
3.0 | Arabidopsis thaliana F-box associated ubiquitination effector protein mRNA | F-box associated ubiquitination effector protein(AT3G16020) | coding protein | psRNATarget | |||||||||
NM_001338198.1 |
|
3.0 | Arabidopsis thaliana F-box associated ubiquitination effector protein mRNA | F-box associated ubiquitination effector protein(AT3G16020) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
3 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
4 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |