ncRNA ID | novel_zma_miR14082 |
Species | Zea mays |
Class | miRNA |
Genome position | Chr6:100566322-100566428 [+] |
Reference genome | RefGen_v4 |
Source | SRR2089699;SRR2089703;SRR2089704 |
Length | 24 |
Mature sequence(if miRNA) | 84 - AUAAUUUUGAAUAAGGAGGGGAUU - 107 |
Stem-loop(if miRNA) |
--                             CUA    AGG    ACAA    G   UCUCCUCCUUAUUCAAAAUUAUAUAAGGA   GUUU   AGCC    AACC G   |||||||||||||||||||||||||||||   ||||   ||||    |||| A   AGGGGAGGAAUAAGUUUUAAUAUAUUCCU   UAAA   UCGG    UUGG G UU                             CUC    --A    GAAA    G |
Stem-loop sequence | UCUCCUCCUUAUUCAAAAUUAUAUAAGGACUAGUUUAGGAGCCACAAAACCGGAGGGGUUAAAGGGCUAAAAUCUCUCCUUAUAUAAUUUUGAAUAAGGAGGGGAUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_020552918.1 |
|
2.5 | PREDICTED: Zea mays negative regulator of systemic acquired resistance SNI1 (LOC103654875), transcript variant X2, mRNA | NA | coding protein | psRNATarget | |||||||||
XM_020552919.1 |
|
2.5 | PREDICTED: Zea mays negative regulator of systemic acquired resistance SNI1 (LOC103654875), transcript variant X3, mRNA | NA | coding protein | psRNATarget | |||||||||
XM_008676338.2 |
|
3.0 | PREDICTED: Zea mays probable inactive purple acid phosphatase 16 (LOC103650765), mRNA | NA | coding protein | psRNATarget |