ncRNA ID | ath-miR781a |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:7423518-7423611 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 6 - UUAGAGUUUUCUGGAUACUUA - 26 |
Stem-loop(if miRNA) |
       -                   UU     C  A A     A UCAAAUU AGAGUUUUCUGGAUACUUA  AGUUA UA C AAGAG G ||||||| |||||||||||||||||||  ||||| || | ||||| G AGUUUAA UCUCAAAAGACCUAUGAAU  UCAAU AU G UUCUU G        A                   UU     U  A C     C |
Stem-loop sequence | UCAAAUUAGAGUUUUCUGGAUACUUAUUAGUUACUAACAAAGAGAGGGCUUCUUCGAUAUUAACUUUUAAGUAUCCAGAAAACUCUAAAUUUGA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AY086502.1 |
|
1.0 | Arabidopsis thaliana clone 25501 mRNA, complete sequence | NA | coding protein | psRNATarget | |||||||||
NM_122255.6 |
|
1.0 | Arabidopsis thaliana SWIB/MDM2, Plus-3 and GYF domain-containing protein mRNA | SWIB/MDM2, Plus-3 and GYF domain-containing protein(AT5G23480) | coding protein | psRNATarget | |||||||||
NM_001343809.1 |
|
1.0 | Arabidopsis thaliana SWIB/MDM2, Plus-3 and GYF domain-containing protein partial mRNA | SWIB/MDM2, Plus-3 and GYF domain-containing protein(AT5G23480) | coding protein | psRNATarget | |||||||||
NM_001343808.1 |
|
1.0 | Arabidopsis thaliana SWIB/MDM2, Plus-3 and GYF domain-containing protein mRNA | SWIB/MDM2, Plus-3 and GYF domain-containing protein(AT5G23480) | coding protein | psRNATarget | |||||||||
NM_001343807.1 |
|
1.0 | Arabidopsis thaliana SWIB/MDM2, Plus-3 and GYF domain-containing protein mRNA | SWIB/MDM2, Plus-3 and GYF domain-containing protein(AT5G23480) | coding protein | psRNATarget | |||||||||
NM_001343806.1 |
|
1.0 | Arabidopsis thaliana SWIB/MDM2, Plus-3 and GYF domain-containing protein mRNA | SWIB/MDM2, Plus-3 and GYF domain-containing protein(AT5G23480) | coding protein | psRNATarget | |||||||||
NM_001343805.1 |
|
1.0 | Arabidopsis thaliana SWIB/MDM2, Plus-3 and GYF domain-containing protein mRNA | SWIB/MDM2, Plus-3 and GYF domain-containing protein(AT5G23480) | coding protein | psRNATarget |
1 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
2 | PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"; Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC; PLoS One. 2:e219(2007). |