Search result

BaseInfo

ncRNA ID	novel_zma_miR5645
Species	Zea mays
Class	miRNA
Genome position	Chr2:79046890-79047000 [-]
Reference genome	RefGen_v4
Source	SRR2638137;SRR2647390
Length	24
Mature sequence(if miRNA)	88 - CUCUAGUAUUGACCCCAAUCCACU - 111
Stem-loop(if miRNA)	--                       U   A              A      CUAA   CUCUAGUAUUGACCCCAAUCCAC UGU UUGAGGUGGAUUGG GUGUAA    A   ||||||||||||||||||||||| ||| |||||||||||||| ||||||    A   GAGAUCAUAACUGGGGUUAGGUG ACA AACUCCACCUAACC CACAUU    C AU                       U   C              C      UAAU
Stem-loop sequence	CUCUAGUAUUGACCCCAAUCCACUUGUAUUGAGGUGGAUUGGAGUGUAACUAAAACUAAUUUACACCCCAAUCCACCUCAACACAUGUGGAUUGGGGUCAAUACUAGAGUA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
HI407232.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   |||||||||*|||||||||||||| targets:46   AGUGGAUUGAGGUCAAUACUAGAG   69 Target Full Sequence	1.0	Sequence 5357 from Patent EP2074227	NA	coding protein	psRNATarget
LQ239362.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   |||||||||*|||||||||||||| targets:46   AGUGGAUUGAGGUCAAUACUAGAG   69 Target Full Sequence	1.0	Sequence 5357 from Patent EP2985353	NA	coding protein	psRNATarget
JB167693.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   |||||||||*|||||||||||||| targets:46   AGUGGAUUGAGGUCAAUACUAGAG   69 Target Full Sequence	1.0	Sequence 5357 from Patent EP2559767	NA	coding protein	psRNATarget
EU963469.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   |||||||||*|||||||||||||| targets:996   AGUGGAUUGAGGUCAAUACUAGAG   1019 Target Full Sequence	1.0	Zea mays clone 263014 mRNA sequence	NA	coding protein	psRNATarget
EZ069719.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:76   UGUGGAUUGAGGUCAAUACUAGAG   99 Target Full Sequence	1.0	TSA: Zea mays contig05355, mRNA sequence	NA	coding protein	psRNATarget
JB163953.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:99   UGUGGAUUGAGGUCAAUACUAGAG   122 Target Full Sequence	1.0	Sequence 1617 from Patent EP2559767	NA	coding protein	psRNATarget
LQ235622.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:99   UGUGGAUUGAGGUCAAUACUAGAG   122 Target Full Sequence	1.0	Sequence 1617 from Patent EP2985353	NA	coding protein	psRNATarget
HI403492.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:99   UGUGGAUUGAGGUCAAUACUAGAG   122 Target Full Sequence	1.0	Sequence 1617 from Patent EP2074227	NA	coding protein	psRNATarget
JB163738.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:107   UGUGGAUUGAGGUCAAUACUAGAG   130 Target Full Sequence	1.0	Sequence 1402 from Patent EP2559767	NA	coding protein	psRNATarget
LQ235407.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:107   UGUGGAUUGAGGUCAAUACUAGAG   130 Target Full Sequence	1.0	Sequence 1402 from Patent EP2985353	NA	coding protein	psRNATarget
HI403277.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:107   UGUGGAUUGAGGUCAAUACUAGAG   130 Target Full Sequence	1.0	Sequence 1402 from Patent EP2074227	NA	coding protein	psRNATarget
EU963895.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||||||||||||| targets:1003   UGUGGAUUGUGGUCAAUACUAGAG   1026 Target Full Sequence	1.0	Zea mays clone 273839 protein SFT2 mRNA, complete cds	NA	coding protein	psRNATarget
BT085111.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||*|||||||||| targets:1214   UGUGGAUUGGGGUAAAUACUAGAG   1237 Target Full Sequence	1.5	Zea mays full-length cDNA clone ZM_BFb0292J13 mRNA, complete cds	NA	coding protein	psRNATarget
XM_008646893.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||*||||||||||||||| targets:3226   UGUGGAUUUGGGUCAAUACUAGAG   3249 Target Full Sequence	1.0	PREDICTED: Zea mays uncharacterized LOC103626481 (LOC103626481), transcript variant X4, mRNA	NA	coding protein	psRNATarget
XM_008646891.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||*||||||||||||||| targets:3312   UGUGGAUUUGGGUCAAUACUAGAG   3335 Target Full Sequence	1.0	PREDICTED: Zea mays uncharacterized LOC103626481 (LOC103626481), transcript variant X1, mRNA	NA	coding protein	psRNATarget
XM_008646892.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||*||||||||||||||| targets:3407   UGUGGAUUUGGGUCAAUACUAGAG   3430 Target Full Sequence	1.0	PREDICTED: Zea mays uncharacterized LOC103626481 (LOC103626481), transcript variant X2, mRNA	NA	coding protein	psRNATarget
EU944570.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   **|||||||*|||||||||||||| targets:730   UUUGGAUUGAGGUCAAUACUAGAG   753 Target Full Sequence	1.0	Zea mays clone 222723 mRNA sequence	NA	coding protein	psRNATarget
BT019026.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   **|||||||*|||||||||||||| targets:951   UUUGGAUUGAGGUCAAUACUAGAG   974 Target Full Sequence	1.0	Zea mays clone Contig531.F mRNA sequence	NA	coding protein	psRNATarget
BT053958.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||||||||||*|* targets:1470   UGUGGAUUGGGGUCAAUACUAAAU   1493 Target Full Sequence	2.5	Zea mays full-length cDNA clone ZM_BFc0073M17 mRNA, complete cds	NA	coding protein	psRNATarget
EU960123.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   **|||||||*|||||||||||||| targets:1577   UUUGGAUUGAGGUCAAUACUAGAG   1600 Target Full Sequence	1.0	Zea mays clone 221999 choline/ethanolamine kinase mRNA, complete cds	NA	coding protein	psRNATarget
BT066939.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||||||||||*|* targets:1544   UGUGGAUUGGGGUCAAUACUAAAU   1567 Target Full Sequence	2.5	Zea mays full-length cDNA clone ZM_BFb0114E07 mRNA, complete cds	NA	coding protein	psRNATarget
BT055962.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||||||||||*|* targets:1676   UGUGGAUUGGGGUCAAUACUAAAU   1699 Target Full Sequence	2.5	Zea mays full-length cDNA clone ZM_BFc0070E08 mRNA, complete cds	NA	coding protein	psRNATarget
NM_001153225.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||||||||||*|* targets:1676   UGUGGAUUGGGGUCAAUACUAAAU   1699 Target Full Sequence	2.5	Zea mays choline/ethanolamine kinase (LOC100280298), mRNA	NA	coding protein	psRNATarget
EU962737.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||||||||||*|* targets:1697   UGUGGAUUGGGGUCAAUACUAAAU   1720 Target Full Sequence	2.5	Zea mays clone 245096 mRNA sequence	NA	coding protein	psRNATarget
XM_020547679.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||||||||||*|* targets:1718   UGUGGAUUGGGGUCAAUACUAAAU   1741 Target Full Sequence	2.5	PREDICTED: Zea mays choline/ethanolamine kinase (LOC100280298), transcript variant X1, mRNA	NA	coding protein	psRNATarget
XM_020547680.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||||||||||||||*|* targets:1731   UGUGGAUUGGGGUCAAUACUAAAU   1754 Target Full Sequence	2.5	PREDICTED: Zea mays choline/ethanolamine kinase (LOC100280298), transcript variant X2, mRNA	NA	coding protein	psRNATarget
LQ239297.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||*|||||||||| targets:88   CGUGGAUUGCGGUGAAUACUAGAG   111 Target Full Sequence	2.5	Sequence 5292 from Patent EP2985353	NA	coding protein	psRNATarget
JB167628.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||*|||||||||| targets:88   CGUGGAUUGCGGUGAAUACUAGAG   111 Target Full Sequence	2.5	Sequence 5292 from Patent EP2559767	NA	coding protein	psRNATarget
HI407167.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||*|||||||||| targets:88   CGUGGAUUGCGGUGAAUACUAGAG   111 Target Full Sequence	2.5	Sequence 5292 from Patent EP2074227	NA	coding protein	psRNATarget
HI403396.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||*||||*|||||||||||||| targets:97   UGUGAAUUGAGGUCAAUACUAGAG   120 Target Full Sequence	1.0	Sequence 1521 from Patent EP2074227	NA	coding protein	psRNATarget
JB163857.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||*||||*|||||||||||||| targets:97   UGUGAAUUGAGGUCAAUACUAGAG   120 Target Full Sequence	1.0	Sequence 1521 from Patent EP2559767	NA	coding protein	psRNATarget
LQ235526.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||*||||*|||||||||||||| targets:97   UGUGAAUUGAGGUCAAUACUAGAG   120 Target Full Sequence	1.0	Sequence 1521 from Patent EP2985353	NA	coding protein	psRNATarget
EU941642.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||**|||||||||||||| targets:33   UGUGGAUUUUGGUCAAUACUAGAG   56 Target Full Sequence	2.0	Zea mays clone 1468727 mRNA sequence	NA	coding protein	psRNATarget
NM_001291617.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||**|||||||||||||| targets:834   UGUGGAUUAUGGUCAAUACUAGAG   857 Target Full Sequence	2.0	Zea mays enhancer of rudimentary-like protein (LOC100383755), mRNA	NA	coding protein	psRNATarget
BT068211.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||**|||||||||||||| targets:834   UGUGGAUUAUGGUCAAUACUAGAG   857 Target Full Sequence	2.0	Zea mays full-length cDNA clone ZM_BFb0077D08 mRNA, complete cds	NA	coding protein	psRNATarget
BT085755.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||**|||||||||||||| targets:906   UGUGGAUUUUGGUCAAUACUAGAG   929 Target Full Sequence	2.0	Zea mays full-length cDNA clone ZM_BFc0057I16 mRNA, complete cds	NA	coding protein	psRNATarget
NM_001156128.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||**|||||||||||||| targets:906   UGUGGAUUUUGGUCAAUACUAGAG   929 Target Full Sequence	2.0	Zea mays protein SFT2 (LOC100283226), mRNA	NA	coding protein	psRNATarget
EU963259.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||**|||||||||||||| targets:1077   UGUGGAUUAUGGUCAAUACUAGAG   1100 Target Full Sequence	2.0	Zea mays clone 259966 enhancer of rudimentary mRNA, complete cds	NA	coding protein	psRNATarget
BT055428.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||||||||*|||*|||||||||| targets:36   CGUGGAUUGAGGUGAAUACUAGAG   59 Target Full Sequence	2.5	Zea mays full-length cDNA clone ZM_BFb0186F19 mRNA, complete cds	NA	coding protein	psRNATarget
XM_008650840.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||*=|||||*|||||||||||| targets:3415   UGUGCGUUGGGAUCAAUACUAGAG   3438 Target Full Sequence	2.5	PREDICTED: Zea mays two-component response regulator ORR24 (LOC103629724), mRNA	NA	coding protein	psRNATarget
XM_008659899.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *|||||||**|||||||||||||* targets:2151   UGUGGAUUUAGGUCAAUACUAGAA   2174 Target Full Sequence	3.0	PREDICTED: Zea mays carotene epsilon-monooxygenase, chloroplastic (LOC103637620), mRNA	NA	coding protein	psRNATarget
EZ108049.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||*|||||*|*|||||||||||| targets:286   UGUAGAUUGAGCUCAAUACUAGAG   309 Target Full Sequence	2.5	TSA: Zea mays contig43707, mRNA sequence	NA	coding protein	psRNATarget
BT066687.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||*|||||*|*|||||||||||| targets:893   UGUAGAUUGAGCUCAAUACUAGAG   916 Target Full Sequence	2.5	Zea mays full-length cDNA clone ZM_BFb0047M01 mRNA, complete cds	NA	coding protein	psRNATarget
NM_001175915.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||*|||||*|*|||||||||||| targets:893   UGUAGAUUGAGCUCAAUACUAGAG   916 Target Full Sequence	2.5	Zea mays U2 small nuclear ribonucleoprotein B'' (LOC100383254), mRNA	NA	coding protein	psRNATarget
EU962825.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||*|||||*|*|||||||||||| targets:977   UGUAGAUUGAGCUCAAUACUAGAG   1000 Target Full Sequence	2.5	Zea mays clone 245793 mRNA sequence	NA	coding protein	psRNATarget
AY103846.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||*|||||*|*|||||||||||| targets:997   UGUAGAUUGAGCUCAAUACUAGAG   1020 Target Full Sequence	2.5	Zea mays PCO130752 mRNA sequence	NA	coding protein	psRNATarget
BT018215.1	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||*|||||*||*||||||||||| targets:1408   UGUUGAUUGAGGCCAAUACUAGAG   1431 Target Full Sequence	2.5	Zea mays clone EL01N0561A07.c mRNA sequence	NA	coding protein	psRNATarget
XM_008648135.2	ncRNA:24   UCACCUAACCCCAGUUAUGAUCUC   1   *||*|||||*||*||||||||||| targets:1365   UGUUGAUUGAGGCCAAUACUAGAG   1388 Target Full Sequence	2.5	PREDICTED: Zea mays uncharacterized LOC103627823 (LOC103627823), mRNA	NA	coding protein	psRNATarget