Search result

BaseInfo

ncRNA ID	ath-miRf10059-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	23
Mature sequence(if miRNA)	NA - ACCACACUUGGAGUCCUCCCACA - NA
Stem-loop(if miRNA)	-      CUC  UA AAACAUGUGGGAGGACUCCAAGUGUGGU UAUAUC   GG  U |||||||||||||||||||||||||||| ||||||   || UUUGUACACCCUCCUGAGGUUCACACCA GUGUAG   UC  U                             A      --C  UA
Stem-loop sequence	AAACAUGUGGGAGGACUCCAAGUGUGGUUAUAUCCUCGGUAUUAUCUCGAUGUGAACCACACUUGGAGUCCUCCCACAUGUUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_104921.1	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ||||||||||||||||||||||| targets:623   UGUGGGAGGACUCCAAGUGUGGU   645 Target Full Sequence	0.0	Arabidopsis thaliana MIF4G domain-containing protein partial mRNA	MIF4G domain-containing protein(AT1G62410)	coding protein	psRNATarget
BT006240.1	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ***||||||||||*||||||||| targets:973   AUAGGGAGGACUCGAAGUGUGGU   995 Target Full Sequence	1.5	Arabidopsis thaliana At1g24268 mRNA, complete cds	NA	coding protein	psRNATarget
BX815955.1	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ***||||||||||*||||||||| targets:1173   AUAGGGAGGACUCGAAGUGUGGU   1195 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZA02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX816089.1	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ***||||||||||*||||||||| targets:1189   AUAGGGAGGACUCGAAGUGUGGU   1211 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH27ZC08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX816261.1	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ***||||||||||*||||||||| targets:1142   AUAGGGAGGACUCGAAGUGUGGU   1164 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZA08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK117725.1	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ***||||||||||*||||||||| targets:1216   AUAGGGAGGACUCGAAGUGUGGU   1238 Target Full Sequence	1.5	Arabidopsis thaliana mRNA for unknown protein, complete cds, clone: RAFL17-40-L02	NA	coding protein	psRNATarget
NM_001036011.1	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ***||||||||||*||||||||| targets:1219   AUAGGGAGGACUCGAAGUGUGGU   1241 Target Full Sequence	1.5	Arabidopsis thaliana bZIP transcription factor, putative (DUF1664) mRNA	bZIP transcription factor, putative (DUF1664)(AT1G24267)	coding protein	psRNATarget
NM_179374.2	ncRNA:23   ACACCCUCCUGAGGUUCACACCA   1   ***||||||||||*||||||||| targets:1216   AUAGGGAGGACUCGAAGUGUGGU   1238 Target Full Sequence	1.5	Arabidopsis thaliana bZIP transcription factor, putative (DUF1664) mRNA	bZIP transcription factor, putative (DUF1664)(AT1G24267)	coding protein	psRNATarget