ncRNA ID | ath-miR159b-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:6220646-6220841 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 5 - GAGCUCCUUGAAGUUCAAUGG - 25 |
Stem-loop(if miRNA) |
------G            GA       U       UU   ------    UG    -      G  A  C     AUC      -----         AAU             GAAGAGCUCCUU  AGUUCAA GGAGGGU  AGC      AGGG  AAGU AAAGCU CU AG UAUGG   CCAUAA     GCCUUAUCA   UCAAUA        ||||||||||||  ||||||| |||||||  |||      ||||  |||| |||||| || || |||||   ||||||     |||||||||   |||||U        CUUCUCGAGGGA  UUAGGUU CUUCUCA  UCG      UCCC  UUCA UUUCGA GA UC AUACC   GGUAUU     UGGAAUAGU   AGUUAA CUCUCUA            AG       U       CU   GUAAUU    CA    C      G  C  U     GUA      UUUUU         ---      |
Stem-loop sequence | GGAAGAGCUCCUUGAAGUUCAAUGGAGGGUUUAGCAGGGUGAAGUAAAGCUGCUAAGCUAUGGAUCCCAUAAGCCUUAUCAAAUUCAAUAUAAUUGAUGAUAAGGUUUUUUUUAUGGAUGCCAUAUCUCAGGAGCUUUCACUUACCCCUUUAAUGGCUUCACUCUUCUUUGGAUUGAAGGGAGCUCUUCAUCUCUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BX826424.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB25ZD03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
NM_119841.6 |
|
2.5 | Arabidopsis thaliana UDP-Glycosyltransferase superfamily protein mRNA | UDP-Glycosyltransferase superfamily protein(AT4G36770) | coding protein | psRNATarget | |||||||||
NM_001333732.1 |
|
3.0 | Arabidopsis thaliana hypothetical protein mRNA | hypothetical protein(AT1G55800) | coding protein | psRNATarget |
1 | PMID:12226481
"Short RNAs can identify new candidate transposable element families in Arabidopsis"; Mette MF, van der Winden J, Matzke M, Matzke AJ; Plant Physiol. 130:6-9(2002). |
2 | PMID:12225663
"CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"; Park W, Li J, Song R, Messing J, Chen X; Curr Biol. 12:1484-1495(2002). |
3 | PMID:12202040
"Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002). |
4 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
5 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
6 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
7 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |