ncRNA ID | osa-miR169i-3p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr8:26803116-26803291 [+] |
Reference genome | MSU7 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 135 - UGAGUCGCUCUUAUCACUCAUG - 156 |
Stem-loop(if miRNA) |
-GGAA    -     G  U     -            UA    U  -          U    U       UC  U  GUA    A     C      GAGA GCAAG CU GCAUG GUGAUAAGGGUG  GCUC GG UAGCCAAGGA GACU GCCUGUG  CU GU   GAGG UCAUU A      |||| ||||| || ||||| ||||||||||||  |||| || |||||||||| |||| |||||||  || ||   |||| ||||| G      CUCU CGUUC GA UGUAC CACUAUUCUCGC  UGAG CU AUCGGUUCCU CUGA CGGAUAC  GG CA   UUCC AGUAA A AGUUG    A     G  U     U            --    U  G          -    -       UU  U  -AG    G     A |
Stem-loop sequence | GGAAGAGAGCAAGGCUUGCAUGGUGAUAAGGGUGUAGCUCUGGUAGCCAAGGAUGACUUGCCUGUGUCCUUGUGUAGAGGAUCAUUCAGAAAAUGAGCCUUGAACUGGUUCAUAGGCAGUCUCCUUGGCUAGUCUGAGUCGCUCUUAUCACUCAUGUUAGGCUUGCAUCUCGUUGA |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:21679406
"Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa"; Wei LQ, Yan LF, Wang T; Genome Biol. 12:R53(2011). |
3 | PMID:22585409
"Novel miRNAs in the control of arsenite levels in rice"; Liu Q; Funct Integr Genomics. 12:649-658(2012). |