ncRNA ID | osa-miR417 |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr8:14939853-14939918 [+] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 44 - GAAUGUAGUGAAUUUGUUCCA - 64 |
Stem-loop(if miRNA) |
UU   U         ---A    UUAA   UCUU   UGG ACAAAUUUG    AUUC    AUC    A   ||| |||||||||    ||||    |||    U   ACC UGUUUAAGU    UAAG    UAG    A GU   U         GAUG    --UA   UAUU |
Stem-loop sequence | UUUGGUACAAAUUUGAAUUCUUAAAUCUCUUAUAUUAUGAUAUGAAUGUAGUGAAUUUGUUCCAUG |
1 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
2 | PMID:16669754
"MicroRNAS and their regulatory roles in plants"; Jones-Rhoades MW, Bartel DP, Bartel B; Annu Rev Plant Biol. 57:19-53(2006). |