ncRNA ID | osa-miR1432-3p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr7:23401702-23401810 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 6 - CAGGUGUCAUCUCCCCUGAAC - 26 |
Stem-loop(if miRNA) |
      A     A           GA     -C    ------       CU    C CCUGUG UCAGG GAGAUGACACC  CAUCG  CGGA      AUUCGUU  UGGU U |||||| ||||| |||||||||||  |||||  ||||      |||||||  |||| U GGAUAC AGUCC CUCUACUGUGG  GUAGU  GCCU      UAAGUAG  ACCG G       A     C           AC     UU    GGUAGU       -U    U |
Stem-loop sequence | CCUGUGAUCAGGAGAGAUGACACCGACAUCGCCGGAAUUCGUUCUUGGUCUUGUGCCAUGAUGAAUUGAUGGUCCGUUUGAUGCAGGUGUCAUCUCCCCUGAACAUAGG |
1 | PMID:18353984
"Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)"; Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ; Proc Natl Acad Sci U S A. 105:4951-4956(2008). |
2 | PMID:18312648
"Identification of novel and candidate miRNAs in rice by high throughput sequencing"; Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK; BMC Plant Biol. 8:25(2008). |
3 | PMID:18323537
"Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa"; Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ; Genome Res. 18:571-584(2008). |
4 | PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"; Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y; PLoS Pathog. 7:e1002176(2011). |