Search result

BaseInfo

ncRNA ID osa-miR1432-3p
Species Oryza sativa
Class miRNA
Genome position Chr7:23401702-23401810 [-]
Reference genome MSU7
Source miRBase
Length 21
Mature sequence(if miRNA) 6 - CAGGUGUCAUCUCCCCUGAAC - 26
Stem-loop(if miRNA)       A     A           GA     -C    ------       CU    C
CCUGUG UCAGG GAGAUGACACC  CAUCG  CGGA      AUUCGUU  UGGU U
|||||| ||||| |||||||||||  |||||  ||||      |||||||  |||| U
GGAUAC AGUCC CUCUACUGUGG  GUAGU  GCCU      UAAGUAG  ACCG G
      A     C           AC     UU    GGUAGU       -U    U
Stem-loop sequence CCUGUGAUCAGGAGAGAUGACACCGACAUCGCCGGAAUUCGUUCUUGGUCUUGUGCCAUGAUGAAUUGAUGGUCCGUUUGAUGCAGGUGUCAUCUCCCCUGAACAUAGG

Reference

1 PMID:18353984
"Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)";
Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ;
Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2 PMID:18312648
"Identification of novel and candidate miRNAs in rice by high throughput sequencing";
Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK;
BMC Plant Biol. 8:25(2008).
3 PMID:18323537
"Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa";
Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ;
Genome Res. 18:571-584(2008).
4 PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors";
Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y;
PLoS Pathog. 7:e1002176(2011).