Search result

BaseInfo

ncRNA ID	osa-miR160e-3p
Species	Oryza sativa
Class	miRNA
Genome position	Chr7:2216761-2216874 [-]
Reference genome	MSU7
Source	miRBase
Length	21
Mature sequence(if miRNA)	9 - GCGUGCGAGGUGCCAAGCAUG - 29
Stem-loop(if miRNA)	GUA    A     C    U  C         CU    UG  U      CC     ACU    GGGG UAUGC UGGC CC UGUAUGCCG  CGCA  GC GCCAAC  AAUGA   C    |||| ||||| |||| || |||||||||  ||||  || ||||||  |||||    UCCC GUACG ACCG GG GCGUGCGGC  GCGU  CG CGGUUG  UUGCU   G UUC    G     A    U  A         AU    --  C      --     CUA
Stem-loop sequence	GUAGGGGAUAUGCCUGGCUCCCUGUAUGCCGCUCGCAUGGCUGCCAACCCAAUGAACUCGAUCUCGUUGUUGGCCGCUGCGUACGGCGUGCGAGGUGCCAAGCAUGGCCCUCUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_015758858.1	ncRNA:21   GUACGAACCGUGGAGCGUGCG   1   *=**||*|||||||||||||| targets:25   AGACCUCGGCACCUCGCACGC   45 Target Full Sequence	3.0	PREDICTED: Oryza sativa Japonica Group zinc finger protein GIS2 (LOC4349279), transcript variant X2, mRNA	zinc finger protein GIS2(LOC4349279)	coding protein	psRNATarget
XM_015758857.1	ncRNA:21   GUACGAACCGUGGAGCGUGCG   1   *=**||*|||||||||||||| targets:30   AGACCUCGGCACCUCGCACGC   50 Target Full Sequence	3.0	PREDICTED: Oryza sativa Japonica Group zinc finger protein GIS2 (LOC4349279), transcript variant X1, mRNA	zinc finger protein GIS2(LOC4349279)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"; Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y; PLoS Pathog. 7:e1002176(2011).