ncRNA ID | osa-miR5814 |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr6:26661349-26661456 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 75 - AAUCAAGUUAGGAACCAUGCAAGU - 98 |
Stem-loop(if miRNA) |
  C        A            C A       UG      -A    U  CC GG UACUGGUA UCAAGUUAGGAA C UGCAAGU  UUUAUG  GUUG GC  U || |||||||| |||||||||||| | |||||||  ||||||  |||| ||  C CC GUGACCGU AGUUCAAUCUUU G ACGUUCA  AGAUAC  CGAU CG  U   U        G            A A       GU      CG    C  UG |
Stem-loop sequence | GGCUACUGGUAAUCAAGUUAGGAACCAUGCAAGUUGUUUAUGAGUUGUGCCCUCUGUGCCUAGCGCCAUAGAUGACUUGCAAGAUUUCUAACUUGAGUGCCAGUGUCC |
1 | PMID:22158467
"Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"; Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ; Plant Cell. 23:4185-4207(2011). |