ncRNA ID | osa-miR1870-5p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr6:21164755-21164963 [+] |
Reference genome | MSU7 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 44 - UGCUGAAUUAGACCUAGUGGGCAU - 67 |
Stem-loop(if miRNA) |
-U         -        G      -    ------        C                A     U      U    C          ---AU  UACUGUUGCC   AGUGUCAAA GUAAUGGA GAUUUG GGAA      AUAAACUG GUUCAUGCUGAAUUAG CCUAG GGGCAU UAUA AUCACAACAC     GG          C   ||||||||| |||||||| |||||| ||||      |||||||| |||||||||||||||| ||||| |||||| |||| ||||||||||     ||          U   UCACAGUUU CAUUACCU CUAAAC CCUU      UAUUUGAU CAAGUACGACUUAAUC GGAUU CCCGUA AUAU UAGUGUUGUG     GA          U AU         U        A      U    ACCUCU        A                G     U      U    C          AUUCC  UCUUUUUCCU |
Stem-loop sequence | UAGUGUCAAAGUAAUGGAGGAUUUGGGAAAUAAACUGCGUUCAUGCUGAAUUAGACCUAGUGGGCAUUUAUACAUCACAACACAUGGUACUGUUGCCCUUUCCUUUUUCUAGCCUUAGUGUUGUGAUCUAUAUAUGCCCUUUAGGGCUAAUUCAGCAUGAACAUAGUUUAUUCUCCAUUCCUCAAAUCAUCCAUUACUUUUGACACUUA |
1 | PMID:18687877
"A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains"; Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C; Genome Res. 18:1456-1465(2008). |
2 | PMID:19903869
"Rice MicroRNA effector complexes and targets"; Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y; Plant Cell. 21:3421-3435(2009). |