ncRNA ID | ath-miR830-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:4820355-4820549 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 119 - UCUUCUCCAAAUAGUUUAGGUU - 140 |
Stem-loop(if miRNA) |
----------------CA    -   G  A  --  CUUUACUAAACACAAAAUCUGUAAACGCCUCGAUCUCCUCUUCUCCAAAUAGUUUAGGUUAGCUGACAUA                   GAGU CUC CU GU  GU                                                                      U                   |||| ||| || ||  ||                   UUCG GAG GG UU  AC                                                                      A GCUACAAGAAGUUUUAAG    U   A  A  GA  AUUAGCGAGAAGCAAGUGAAGAAGAGUUUUAUCAAUCCAAUAGACCUCUUUGACCCCAGAUAACUUAAUA |
Stem-loop sequence | CAGAGUCUCGCUAGUGUCUUUACUAAACACAAAAUCUGUAAACGCCUCGAUCUCCUCUUCUCCAAAUAGUUUAGGUUAGCUGACAUAUAAUAAUUCAAUAGACCCCAGUUUCUCCAGAUAACCUAACUAUUUUGAGAAGAAGUGAACGAAGAGCGAUUACAAGUUAGGAGAGUGCUUGAAUUUUGAAGAACAUCG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AK221156.1 |
|
2.0 | Arabidopsis thaliana mRNA for hypothetical protein, partial cds, clone: RAFL22-95-C22 | NA | coding protein | psRNATarget | |||||||||
AY140094.1 |
|
2.0 | Arabidopsis thaliana unknown protein mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY037180.1 |
|
2.0 | Arabidopsis thaliana At1g52380/F19K6_4 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_104116.4 |
|
2.0 | Arabidopsis thaliana NUP50 (Nucleoporin 50 kDa) protein mRNA | NUP50 (Nucleoporin 50 kDa) protein(AT1G52380) | coding protein | psRNATarget | |||||||||
NM_001333541.1 |
|
2.0 | Arabidopsis thaliana NUP50 (Nucleoporin 50 kDa) protein mRNA | NUP50 (Nucleoporin 50 kDa) protein(AT1G52380) | coding protein | psRNATarget | |||||||||
NM_001333543.1 |
|
2.0 | Arabidopsis thaliana NUP50 (Nucleoporin 50 kDa) protein mRNA | NUP50 (Nucleoporin 50 kDa) protein(AT1G52380) | coding protein | psRNATarget | |||||||||
NM_001333542.1 |
|
2.0 | Arabidopsis thaliana NUP50 (Nucleoporin 50 kDa) protein mRNA | NUP50 (Nucleoporin 50 kDa) protein(AT1G52380) | coding protein | psRNATarget | |||||||||
NM_001203088.2 |
|
2.5 | Arabidopsis thaliana P-loop containing nucleoside triphosphate hydrolases superfamily protein mRNA | P-loop containing nucleoside triphosphate hydrolases superfamily protein(AT3G45850) | coding protein | psRNATarget | |||||||||
NM_114454.3 |
|
2.5 | Arabidopsis thaliana P-loop containing nucleoside triphosphate hydrolases superfamily protein mRNA | P-loop containing nucleoside triphosphate hydrolases superfamily protein(AT3G45850) | coding protein | psRNATarget | |||||||||
NM_119819.1 |
|
2.5 | Arabidopsis thaliana transmembrane protein partial mRNA | transmembrane protein(AT4G36560) | coding protein | psRNATarget |
1 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
2 | PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"; Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC; PLoS One. 2:e219(2007). |
3 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |