ncRNA ID | osa-miR171c-5p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr4:31713472-31713570 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 70 - GGAUAUUGGUGCGGUUCAAUC - 90 |
Stem-loop(if miRNA) |
GU  GA   G        UG             A  CUU U     GAA   GG  ACG GAUAUUGG  CGGUUCAAUCAGA AG   G GCUCC   G   ||  ||| ||||||||  ||||||||||||| ||   | |||||   CC  UGC CUAUAACC  GCCGAGUUAGUUU UC   C CGGGG   G UU  GC   A        GU             C  -AC U     AGC |
Stem-loop sequence | GUGGGAACGGGAUAUUGGUGCGGUUCAAUCAGAAAGCUUGUGCUCCGAAGGCGAGGGGCUCCACUCUUUGAUUGAGCCGUGCCAAUAUCACGUCGCCUU |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"; Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y; PLoS Pathog. 7:e1002176(2011). |