ncRNA ID | osa-miR5485 |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr3:22088075-22088192 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 88 - UGACAACUGGUAGCAGAGCAA - 108 |
Stem-loop(if miRNA) |
-         G      C     G             U UCCACUU      U      G U  CUUGGAGUG UGACAA UGGUA CAGAGCAAUGUCA C       GCCGGU GUUCCU G A  ||||||||| |||||| ||||| ||||||||||||| |       |||||| |||||| | U  GGAUCUCAC GCUGUU ACCAU GUCUCGUUACAGU G       UGGUCA UAGGGA C G C         G      A     A             C -------      -      G U |
Stem-loop sequence | CUUGGAGUGGUGACAACUGGUAGCAGAGCAAUGUCAUCUCCACUUGCCGGUUGUUCCUGGUAUGUCGAGGGAUACUGGUGCUGACAUUGCUCUGAUACCAAUUGUCGGCACUCUAGGC |
1 | PMID:21679406
"Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa"; Wei LQ, Yan LF, Wang T; Genome Biol. 12:R53(2011). |
2 | PMID:22158467
"Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"; Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ; Plant Cell. 23:4185-4207(2011). |