ncRNA ID | osa-miR171e-5p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr3:1970487-1970605 [+] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 13 - UGUUGGCUCGGCUCACUCAGA - 33 |
Stem-loop(if miRNA) |
-U    G   U         U       C     C     UGGC    U  ---A       C   GGUA CUA GAUGUUGGC CGGCUCA UCAGA GGCAU    GUGA GC    AAGCAUG A   |||| ||| ||||||||| ||||||| ||||| |||||    |||| ||    |||||||   UCGU GAU CUAUAACCG GCCGAGU AGUCU UUGUG    CACU CG    UUCGUGC U UC    -   U         U       U     -     --UU    -  AUCG       G |
Stem-loop sequence | UGGUAGCUAUGAUGUUGGCUCGGCUCACUCAGACGGCAUUGGCGUGAUGCAAAGCAUGCAUGCGUGCUUGCUAGCUCACUUGUGUUUCUGAUUGAGCCGUGCCAAUAUCUUAGUGCUCU |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"; Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y; PLoS Pathog. 7:e1002176(2011). |