ncRNA ID | osa-miR418 |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr2:35182622-35182703 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 21 - UAAUGUGAUGAUGAAAUGACG - 41 |
Stem-loop(if miRNA) |
C  U  -  GUCU   -AUC   --    C           CA  GU AG CU    GCA    UGC  CAUU UUAUCAUCGCA  U  || || ||    |||    |||  |||| |||||||||||  U  CA UC GA    UGU    ACG  GUAA AGUAGUAGUGU  U C  C  U  --AC   CUUU   CA    -           AA |
Stem-loop sequence | CGUUAGCUGUCUGCAAUCUGCCAUUCUUAUCAUCGCACAUUUAAUGUGAUGAUGAAAUGACGCAUUUCUGUCAAGUCUCACC |
1 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
2 | PMID:16669754
"MicroRNAS and their regulatory roles in plants"; Jones-Rhoades MW, Bartel DP, Bartel B; Annu Rev Plant Biol. 57:19-53(2006). |