Search result

BaseInfo

ncRNA ID ath-miR472-5p
Species Arabidopsis thaliana
Class miRNA
Genome position chr1:4182132-4182299 [-]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 135 - AUGGUCGAAGUAGGCAAAAUC - 155
Stem-loop(if miRNA) UC          -     U  A      C       C  - -UU   --A   GA      AUGAAU    UG  ---AU    G   GA
  UGUAUGUAUG UAUGG CG AGUAGG AAAAUCU AC C   UCU   GCA  UCAACA      UUUG  GA     AGAU UUG  U
  |||||||||| ||||| || |||||| ||||||| || |   |||   |||  ||||||      ||||  ||     |||| |||
  ACAUACAUAC AUACC GC UCAUCC UUUUAGA UG G   AGA   CGU  AGUUGU      GAAC  UU     UUUG AAU  U
CC          C     C  C      U       A  A UUU   ACG   AG      ------    GU  GUGGU    G   GU
Stem-loop sequence UCUGUAUGUAUGUAUGGUCGAAGUAGGCAAAAUCUCACCUUUCUAGCAGAUCAACAAUGAAUUUUGUGGAAUAGAUGUUGGAUUUGUAAGGUUUUGGUGUUUGCAAGUGUUGAGAUGCGCAAGAUUUGAGUAAGAUUUUUCCUACUCCGCCCAUACCAUACAUACACC

Reference

1 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
2 PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes";
Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC;
PLoS One. 2:e219(2007).
3 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
4 PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots";
Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA;
BMC Genomics. 14:701(2013).