ncRNA ID | osa-miR168a-3p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr2:1553154-1553240 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 9 - GAUCCCGCCUUGCACCAAGUGAAU - 32 |
Stem-loop(if miRNA) |
  C   G GC             AU     C   CC   G   C CG CUC G  UCGCUUGGUGCAG  CGGGA CCG  GCC CCG U || ||| |  |||||||||||||  ||||| |||  ||| ||| GC GAG C  AGUGAACCACGUU  GCCCU GGC  CGG GGC G   C   G UA             CC     A   --   -   C |
Stem-loop sequence | CGCCUCGGGCUCGCUUGGUGCAGAUCGGGACCCGCCGCCGCCGCUGCCGGGGCCGGAUCCCGCCUUGCACCAAGUGAAUCGGAGCCG |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:19903869
"Rice MicroRNA effector complexes and targets"; Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y; Plant Cell. 21:3421-3435(2009). |