ncRNA ID | osa-miR167h-5p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr12:25480618-25480737 [+] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 11 - UGAAGCUGCCAGCAUGAUCUG - 31 |
Stem-loop(if miRNA) |
C  A   U           C             GA    GA      -ACCUCUC   UCUG  AC AGU GGUGAAGCUGC AGCAUGAUCUGAU  UGAU  UGAUCC        UCA    U  || ||| ||||||||||| |||||||||||||  ||||  ||||||        |||  UG UCG CUACUUUGAUG UCGUACUGGACUA  GCUA  ACUAGG        AGU    G U  G   U           -             --    --      CAUUAAUU   UCUU |
Stem-loop sequence | CACAAGUUGGUGAAGCUGCCAGCAUGAUCUGAUGAUGAUGAUGAUCCACCUCUCUCAUCUGUGUUCUUGAUUAAUUACGGAUCAAUCGAUCAGGUCAUGCUGUAGUUUCAUCUGCUGGUU |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"; Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y; PLoS Pathog. 7:e1002176(2011). |