Search result

BaseInfo

ncRNA ID osa-miR5519
Species Oryza sativa
Class miRNA
Genome position Chr12:24358353-24358422 [+]
Reference genome MSU7
Source miRBase
Length 21
Mature sequence(if miRNA) 11 - UGGCAGAAGUACUGGACUUAG - 31
Stem-loop(if miRNA) C         U       - UA     --      G
 UGUGGGCGU GGCAGAA G  CUGGA  CUUAGC G
 ||||||||| ||||||| |  |||||  ||||||
 ACGCCUGUA UCGUCUU C  GACUU  GGAUCG G
U         -       A UC     CG      C
Stem-loop sequence CUGUGGGCGUUGGCAGAAGUACUGGACUUAGCGGGCGCUAGGGCUUCAGCUCAUUCUGCUAUGUCCGCAU

Reference

1 PMID:21679406
"Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa";
Wei LQ, Yan LF, Wang T;
Genome Biol. 12:R53(2011).
2 PMID:22158467
"Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage";
Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ;
Plant Cell. 23:4185-4207(2011).