ncRNA ID | ath-miR829.1 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | NA |
Reference genome | NA |
Source | PNRD |
Length | 24 |
Mature sequence(if miRNA) | NA - AGCUCUGAUACCAAAUGAUGGAAU - NA |
Stem-loop(if miRNA) |
ACG  AAA   GAUUAACAAAAAGUCAAUGAAUCAUUCUACCAAUUGACUUGUACUUUGAAGCUUUGAUUUGAACCUGUCAAUUGGUAUCAAAGCUUCUAAAUC    UC   AUU                                                                                             U    ||   |||    AG   UUC                                                                                             U --U  ---   UACCAUUUGAGCUUCACGAAAAAGAAAAGAGACGGUUCUACUGAUGAUGGAACUUCGAAAUUAAACUAAGGUAGUAAACCAUAGUCUCGAAGU |
Stem-loop sequence | ACGUCAAAAUUGAUUAACAAAAAGUCAAUGAAUCAUUCUACCAAUUGACUUGUACUUUGAAGCUUUGAUUUGAACCUGUCAAUUGGUAUCAAAGCUUCUAAAUCUUUGAAGCUCUGAUACCAAAUGAUGGAAUCAAAUUAAAGCUUCAAGGUAGUAGUCAUCUUGGCAGAGAAAAGAAAAAGCACUUCGAGUUUACCAUCUUGAU |
1 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
2 | PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"; Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC; PLoS One. 2:e219(2007). |
3 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |
4 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |