ncRNA ID | osa-miR166g-5p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr12:18329367-18329511 [+] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 15 - AAUGGAGGCUGAUCCAAGAUC - 35 |
Stem-loop(if miRNA) |
          CU         G   A   A     AUU   UGGUGCAAAAUACUAGGGCAUUGUUGUAAGU AGCAUGGUGU  GGAAUGGAG CUG UCC AGAUC   GCU                               G ||||||||||  ||||||||| ||| ||| |||||   |||                               C UCGUGCCACA  CCUUACUUC GAC AGG UCUAG   AGC                               C           CU         G   C   C     --G   UAUUGUUUGAGCCUUUGUUUUUUCUUGAUUA |
Stem-loop sequence | AGCAUGGUGUCUGGAAUGGAGGCUGAUCCAAGAUCAUUGCUUGGUGCAAAAUACUAGGGCAUUGUUGUAAGUGCCAUUAGUUCUUUUUUGUUUCCGAGUUUGUUAUCGAGGAUCUCGGACCAGGCUUCAUUCCUCACACCGUGCU |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"; Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y; PLoS Pathog. 7:e1002176(2011). |