ncRNA ID | osa-miR5159 |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr11:11920712-11920787 [+] |
Reference genome | MSU7 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 51 - AACUAGAGUGGGUCAACGGGUACC - 74 |
Stem-loop(if miRNA) |
--U             G                 CCAA    GUACCUGUUGACU ACUCUGGUUCAACAAAA    U    ||||||||||||| |||||||||||||||||    CAUGGGCAACUGG UGAGAUCAAGUUGUUUU    U ACC             G                 CAUU |
Stem-loop sequence | UGUACCUGUUGACUGACUCUGGUUCAACAAAACCAAUUUUACUUUUGUUGAACUAGAGUGGGUCAACGGGUACCCA |
1 | PMID:21525786
"Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus"; Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D; RNA Biol. 8:538-547(2011). |
2 | PMID:22158467
"Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"; Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ; Plant Cell. 23:4185-4207(2011). |