Search result

BaseInfo

ncRNA ID	osa-miR171d-3p
Species	Oryza sativa
Class	miRNA
Genome position	Chr10:21237313-21237447 [+]
Reference genome	MSU7
Source	miRBase
Length	21
Mature sequence(if miRNA)	105 - UGAUUGAGCCGUGCCAAUAUC - 125
Stem-loop(if miRNA)	UUGUA   AU         C       C     ----------    U   C G    -GA   G     GA      GCU  GAUGUUGGC CGGCUCA UCAGA          UGGA CAU G UGCA   AGA UGCAU  A      |||  ||||||||| ||||||| |||||          |||| ||| | ||||   ||| |||||  U      CGA  CUAUAACCG GCCGAGU AGUCU          ACCU GUA U AUGU   UCU ACGUA  C UACCA   CU         U       U     UCAAGGUCGU    C   - G    GAC   G     GU
Stem-loop sequence	UUGUAGCUAUGAUGUUGGCCCGGCUCACUCAGAUGGAUCAUCGGUGCAGAAGAGUGCAUGAAUCUGAUGCAGUCUCAGUGUAGUAUGCUCCAUGCUGGAACUUCUGAUUGAGCCGUGCCAAUAUCUCAGCACCAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
JX310318.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:441   GAUAUUGGCGCGGCUCAAUCA   461 Target Full Sequence	1.5	Oryza sativa cultivar Dongjin scarecrow-like transcription factor GRAS1 (GRAS1) mRNA, complete cds	NA	coding protein	psRNATarget
AK066248.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:906   GAUAUUGGCGCGGCUCAAUCA   926 Target Full Sequence	1.5	Oryza sativa Japonica Group cDNA clone:J013055O11, full insert sequence	NA	coding protein	psRNATarget
AK120317.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:906   GAUAUUGGCGCGGCUCAAUCA   926 Target Full Sequence	1.5	Oryza sativa Japonica Group cDNA clone:J013055O12, full insert sequence	NA	coding protein	psRNATarget
AK100757.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1324   GAUAUUGGCGCGGCUCAAUCA   1344 Target Full Sequence	1.5	Oryza sativa Japonica Group cDNA clone:J023118P13, full insert sequence	NA	coding protein	psRNATarget
AK072900.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1351   GAUAUUGGCGCGGCUCAAUCA   1371 Target Full Sequence	1.5	Oryza sativa Japonica Group cDNA clone:J023145A02, full insert sequence	NA	coding protein	psRNATarget
XM_015781657.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1476   GAUAUUGGCGCGGCUCAAUCA   1496 Target Full Sequence	1.5	PREDICTED: Oryza sativa Japonica Group scarecrow-like protein 27 (LOC4336617), mRNA	scarecrow-like protein 27(LOC4336617)	coding protein	psRNATarget
XM_015771930.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1375   GAUAUUGGCGCGGCUCAAUCA   1395 Target Full Sequence	1.5	PREDICTED: Oryza sativa Japonica Group scarecrow-like protein 6 (LOC4330230), transcript variant X2, mRNA	scarecrow-like protein 6(LOC4330230)	coding protein	psRNATarget
AK101035.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1527   GAUAUUGGCGCGGCUCAAUCA   1547 Target Full Sequence	1.5	Oryza sativa Japonica Group cDNA clone:J023150P14, full insert sequence	NA	coding protein	psRNATarget
XM_015771585.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1524   GAUAUUGGCGCGGCUCAAUCA   1544 Target Full Sequence	1.5	PREDICTED: Oryza sativa Japonica Group scarecrow-like protein 6 (LOC4330231), mRNA	scarecrow-like protein 6(LOC4330231)	coding protein	psRNATarget
XM_015771929.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1375   GAUAUUGGCGCGGCUCAAUCA   1395 Target Full Sequence	1.5	PREDICTED: Oryza sativa Japonica Group scarecrow-like protein 6 (LOC4330230), transcript variant X1, mRNA	scarecrow-like protein 6(LOC4330230)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"; Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y; PLoS Pathog. 7:e1002176(2011).