ncRNA ID | osa-miR319a-5p |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr1:26823282-26823472 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 116 - AGCUGCCGAAUCAUCCAUUCA - 136 |
Stem-loop(if miRNA) |
---  U     AA A    U            CU U        U        --UUA      G   AA       U  AC         AAGU    G    UG GUAAG  G GAGC CUCUUCAGUCCA  C CAGAUGGC GUAGGGUU     UUAGCU CCG  UCAUCCA UC  CUACCAAGA    UGCA G    || |||||  | |||| ||||||||||||  | |||||||| ||||||||     |||||| |||  ||||||| ||  |||||||||    ||||    AC CGUUC  C CUCG GGGAAGUCAGGU  G GUUUGCCG CGUCUCGA     AAUCGA GGC  AGUAGGU AG  GAUGGUUCU    AUGU A CGA  U     -- -    U            UG U        -        UUUAA      G   GC       C  GC         --CU    G |
Stem-loop sequence | UGUGUAAGAAGAGAGCUCUCUUCAGUCCACUCUCAGAUGGCUGUAGGGUUUUAUUAGCUGCCGAAUCAUCCAUUCACCUACCAAGAAAGUUGCAGGAGUGUAUCUCUUGGUAGCGGACUGGAUGACGCGGGAGCUAAAAUUUAGCUCUGCGCCGUUUGUGGUUGGACUGAAGGGUGCUCCCUUGCUCAAGC |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:21525786
"Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus"; Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D; RNA Biol. 8:538-547(2011). |