ncRNA ID | osa-miR5143a |
Species | Oryza sativa |
Class | miRNA |
Genome position | Chr1:8417107-8417315 [-] |
Reference genome | MSU7 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 13 - UGUGGUAUGUUGGCAAUGUAGGAA - 36 |
Stem-loop(if miRNA) |
----CC   U       -     A             A  C   A    G UG C  C     CACUAUCAAGACACUUCUCCCA    AUUU    UGUUGAGCAUCAGGACAU       UCA ACUUCCU CAUUG CCAAUAUACCACA AA ACU CAAU U  G CU UUUAC                      GUCC    UGUC                  U       ||| ||||||| ||||| ||||||||||||| || ||| |||| |  | || |||||                      ||||    ||||                  A       AGU UGAAGGA GUAAC GGUUGUAUGGUGU UU UGA GUUG G  C GA AAAUG                      UACA    UCUC                  A AUGCUA   C       U     -             A  U   C    G GU U  C     --------------UCUCCUAC    ----    GUUCCGUGAGGUGUGAAU |
Stem-loop sequence | CCUCAUACUUCCUCAUUGACCAAUAUACCACAAAACACUACAAUGUUGGCCUCUUUACCACUAUCAAGACACUUCUCCCAGUCCAUUUUGUCUGUUGAGCAUCAGGACAUUAAUAAGUGUGGAGUGCCUUGCUCUACAUCAUCCUCUGUAAACAGUCUGGGGUUGCAGUUUUAUGUGGUAUGUUGGCAAUGUAGGAAGUCUGAAUCGUA |
1 | PMID:21525786
"Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus"; Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D; RNA Biol. 8:538-547(2011). |
2 | PMID:22158467
"Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"; Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ; Plant Cell. 23:4185-4207(2011). |