ncRNA ID | lus-miR398c |
Species | Linum usitatissimum |
Class | miRNA |
Genome position | NA |
Reference genome | NA |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | NA - UGUGUUCUCAGGUCACCCCU - NA |
Stem-loop(if miRNA) |
   -AA        CA      A        C    -   ---UU    -C      GGC   GAGGGGUG  ACCUGA AACACAGA GACG GAU     UAGU  GCUUGG |||   ||||||||  |||||| |||||||| |||| |||     ||||  |||||U CCG   CUCCCCAC  UGGACU UUGUGUCU CUGC CUA     AUCA  UGAGCU    GAC        --      C        -    U   UUCAU    AU      |
Stem-loop sequence | GGCAAGAGGGGUGCAACCUGAAAACACAGACGACGGAUUUUAGUCGCUUGGUUCGAGUUAACUAUACUUAUCUCGUCUCUGUGUUCUCAGGUCACCCCUCCAGGCC |
1 | PMID:23291876
"Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes"; Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY; Planta. 237:1149-1161(2013). |