ncRNA ID | ath-miR171b-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:3961348-3961464 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 20 - UUGAGCCGUGCCAAUAUCACG - 40 |
Stem-loop(if miRNA) |
-----UGCAA   --AA    A      A UG          A     --    C    UAA           GGU    CGCG GAUAUU G  CGGUUCAAUC AAUAG  UCGU CUCU   C           |||    |||| |||||| |  |||||||||| |||||  |||| ||||           CCA    GCGC CUAUAA C  GCCGAGUUAG UUGUU  GGCA GAGG   U ACGGUAAAAA   AAUG    A      C GU          C     GU    A    UAC |
Stem-loop sequence | UGCAAGGUAACGCGAGAUAUUAGUGCGGUUCAAUCAAAUAGUCGUCCUCUUAACUCAUGGAGAACGGUGUUGUUCGAUUGAGCCGUGCCAAUAUCACGCGGUAAACCAAAAAUGGCA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AF036303.1 |
|
2.5 | Arabidopsis thaliana scarecrow-like 6 (SCL6) mRNA, partial cds | NA | coding protein | psRNATarget | |||||||||
BX820692.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH60ZB03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY133537.1 |
|
2.5 | Arabidopsis thaliana At4g00150/F6N15_20 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX826491.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB30ZC05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
BX827001.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB85ZC09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
BX826648.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB50ZC05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY096372.1 |
|
2.5 | Arabidopsis thaliana putative scarecrow protein (At3g60630) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BT053760.1 |
|
2.5 | Arabidopsis thaliana unknown protein (At2g45160) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BT020591.1 |
|
2.5 | Arabidopsis thaliana At2g45160 gene, complete cds | NA | coding protein | psRNATarget | |||||||||
AF462831.1 |
|
2.5 | Arabidopsis thaliana AT4g00150/F6N15_20 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX819093.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB45ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY064062.1 |
|
2.5 | Arabidopsis thaliana putative scarecrow protein (At3g60630) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX823015.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB80ZC11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
BT004053.1 |
|
2.5 | Arabidopsis thaliana clone RAFL15-13-A09 (R20463) putative SCARECROW gene regulator (At2g45160) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_116232.5 |
|
2.5 | Arabidopsis thaliana GRAS family transcription factor (HAM3), mRNA | GRAS family transcription factor(HAM3) | coding protein | psRNATarget | |||||||||
NM_115927.5 |
|
2.5 | Arabidopsis thaliana GRAS family transcription factor (HAM2), mRNA | GRAS family transcription factor(HAM2) | coding protein | psRNATarget | |||||||||
NM_130079.3 |
|
2.5 | Arabidopsis thaliana GRAS family transcription factor (HAM1), mRNA | GRAS family transcription factor(HAM1) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
3 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
4 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
5 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
6 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |