ncRNA ID | lus-miR393d |
Species | Linum usitatissimum |
Class | miRNA |
Genome position | NA |
Reference genome | NA |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | NA - UCCAAAGGGAUCGCAUUGAUC - NA |
Stem-loop(if miRNA) |
   CU   --------      -  UC UC      GA     ------------------    --UUU        C             U       UCAUGAU  U   AUAUAUAUCUAUAUA CUU  CCA        UCUGUU CU  G  AGCUUU  UUAGU                  GCAG     GAGAGUUC AAAGGGAUCGCAU GAUCUAA       GA GAU               U |||  |||        |||||| ||  |  ||||||  |||||                  ||||     |||||||| ||||||||||||| |||||||       || ||| GAA  GGU        AGACGA GA  C  UCGAAG  AAUCG                  CGUC     CUCUUAAG UUUCCCUAGCGUA CUAGAUU       GU UAA               C    AU   CAUAUAUU      C  -U GA      --     ACCCAUACAUCAAAUCUC    UCUAC        C             -       -------  -   UUGAUUGACCACCUU |
Stem-loop sequence | CUUCUCCAUCUGUUCUUCGUCAGCUUUGAUUAGUGCAGUUUGAGAGUUCCAAAGGGAUCGCAUUGAUCUAAUCAUGAUGAUGAUAUAUAUAUCUAUAUAUCUUCCACCAGUUAGUUAAUUGUUAGAUCAUGCGAUCCCUUUCGAAUUCUCCAUCUCUGCCUCUAAACUACAUACCCAGCUAAGAAGCUAGCUAGCAGCAGAUUAUAUACUGGUAAAG |
1 | PMID:23291876
"Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes"; Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY; Planta. 237:1149-1161(2013). |