ncRNA ID | lus-miR171b |
Species | Linum usitatissimum |
Class | miRNA |
Genome position | NA |
Reference genome | NA |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | NA - UGAUUGAGCCGUGCCAAUAUC - NA |
Stem-loop(if miRNA) |
     U  A  UAUAA       C  CAC  C         C       C      ACA   CGCUAGCG CUUGU GU UG     UGAAAGG GC   UG GGUAUUGGC CGGUUCA UCAGAC   GCU        C ||||| || ||     ||||||| ||   || ||||||||| ||||||| ||||||   ||| GAACG UA GC     ACUUUCC CG   AC CUAUAACCG GCCGAGU AGUUUG   UAU        A      C  -  ---UC       A  -UA  U         U       U      ---   AUAUUUAU |
Stem-loop sequence | CUUGUUGUAUGUAUAAUGAAAGGCGCCACUGCGGUAUUGGCCCGGUUCACUCAGACACAGCUCGCUAGCGCAUAUUUAUAUAUGUUUGAUUGAGCCGUGCCAAUAUCUCAAUGCACCUUUCACUCGAUCGCAAG |
1 | PMID:23291876
"Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes"; Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY; Planta. 237:1149-1161(2013). |