Search result

BaseInfo

ncRNA ID	ath-miR172e-5p
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr5:23988472-23988596 [+]
Reference genome	TAIR10
Source	miRBase
Length	20
Mature sequence(if miRNA)	13 - GCAGCACCAUUAAGAUUCAC - 32
Stem-loop(if miRNA)	GUAGUC  A         C           A  AGA    U  UU     ---   -UU   C       GC GAUGCAGCA CAUUAAGAUUC CA   GAUG GG  CCCUU   UGC   UCG C       || ||||||||| ||||||||||| ||   |||| ||  |||||   |||   ||| U       CG CUACGUCGU GUAGUUCUAAG GU   CUAU CC  GGGAA   ACG   AGC C CAUAAA  A         A           G  GAG    U  UU     AAG   CCU   U
Stem-loop sequence	GUAGUCGCAGAUGCAGCACCAUUAAGAUUCACAAGAGAUGUGGUUCCCUUUGCUUUCGCCUCUCGAUCCGCAGAAAAGGGUUCCUUAUCGAGUGGGAAUCUUGAUGAUGCUGCAUCAGCAAAUAC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX820988.1	ncRNA:20   CACUUAGAAUUACCACGACG   1   |*|||||||*|||||||||| targets:1672   GAGAAUCUUUAUGGUGCUGC   1691 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH89ZF10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
U52851.2	ncRNA:20   CACUUAGAAUUACCACGACG   1   |*|||||||*|||||||||| targets:1637   GAGAAUCUUUAUGGUGCUGC   1656 Target Full Sequence	2.5	Arabidopsis thaliana arginine decarboxylase (ARGdc) mRNA, complete cds	NA	coding protein	psRNATarget
BT008636.1	ncRNA:20   CACUUAGAAUUACCACGACG   1   |*|||||||*|||||||||| targets:1690   GAGAAUCUUUAUGGUGCUGC   1709 Target Full Sequence	2.5	Arabidopsis thaliana clone RAFL09-94-E10 (R19735) putative arginine decarboxylase (At2g16500) mRNA, complete cds	NA	coding protein	psRNATarget
NM_127204.3	ncRNA:20   CACUUAGAAUUACCACGACG   1   |*|||||||*|||||||||| targets:1781   GAGAAUCUUUAUGGUGCUGC   1800 Target Full Sequence	2.5	Arabidopsis thaliana arginine decarboxylase 1 (ADC1), mRNA	arginine decarboxylase 1(ADC1)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
3	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
4	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).