ncRNA ID | lus-miR166c |
Species | Linum usitatissimum |
Class | miRNA |
Genome position | NA |
Reference genome | NA |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | NA - UCGGACCAGGCUUCAUUCCCC - NA |
Stem-loop(if miRNA) |
     UU U  CUU   U        UC         AA -     GUAGCUAGCUA GAAGC  G GU   UUG GGGGAAUG  GUCUGGUCC  G GCUAG           G |||||  | ||   ||| ||||||||  |||||||||  | ||||| CUUCG  C CA   AAC CCCCUUAC  CGGACCAGG  C UGUUA           A      UU U  -UU   U        UU         CU C     UGUUGAUGAUA |
Stem-loop sequence | GAAGCUUGUGUCUUUUGUGGGGAAUGUCGUCUGGUCCAAGGCUAGGUAGCUAGCUAGAAUAGUAGUUGUAUUGUCCUCGGACCAGGCUUCAUUCCCCUCAAUUACUCUUGCUUC |
1 | PMID:23291876
"Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes"; Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY; Planta. 237:1149-1161(2013). |