ncRNA ID | ath-miR8181 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr5:21641177-21641308 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 113 - UGGGGGUGGGGGGGUGACAG - 132 |
Stem-loop(if miRNA) |
U     UG G G  U     --A   -A         CG      CAUGA        GCAC   UU   G  GGGGG  G G GG GACAG   GAC  UUCUUCAUU  UAUGCU     UGACGUCA    GGG  CAU G  |||||  | | || |||||   |||  |||||||||  ||||||     ||||||||    |||  ||| U  CUCCU  U C UC UUGUC   UUG  AGGAAGUAG  GUACGA     AUUGUAGU    UCU  GUG U A     GG G G  -     GUU   AA         AU      -----        ----   GG   U |
Stem-loop sequence | UGGGGGUGGGGGGGUGACAGAGACAUUCUUCAUUCGUAUGCUCAUGAUGACGUCAGCACGGGUUCAUGGUUUGUGGGUCUUGAUGUUAAGCAUGUAGAUGAAGGAAAGUUUUGCUGUUCUGCGUGGUCCUCA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BX831911.1 |
|
3.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH39ZB07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
BX833924.1 |
|
3.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL83ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget |
1 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |