ncRNA ID | ath-miR870-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr5:21395545-21395629 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 60 - AAGAACAUCAAAUUAGAAUGU - 80 |
Stem-loop(if miRNA) |
          -            A    A      AC    A GAUCGAAGAA CAUCAAAUUAGA UGUG UGCAAA  UUAG C |||||||||| |||||||||||| |||| ||||||  |||| CUAGCUUCUU GUGGUUUAAUCU ACAC ACGUUU  AAUC U           U            A    A      AC    C |
Stem-loop sequence | GAUCGAAGAACAUCAAAUUAGAAUGUGAUGCAAAACUUAGACUCCUAACAUUUGCAACACAAUCUAAUUUGGUGUUUCUUCGAUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BX823557.1 |
|
2.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS50ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget |
1 | PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"; Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC; PLoS One. 2:e219(2007). |
2 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |