ncRNA ID | gra-miR8634 |
Species | Gossypium raimondii |
Class | miRNA |
Genome position | chr6:37108599-37108759 [-] |
Reference genome | Graimondii2_0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 131 - UUGGUAUGGAGGAUGGAAAAG - 151 |
Stem-loop(if miRNA) |
A    C   C                       UG A            A      A  A  CC   A  C    UCACU  AAGC UUG UUGGUAUGGAGGAUGGAAAAGAG  A GAUGGAAAAUUU UUAAUC AA GG  AAG UU ACAA     U  |||| ||| |||||||||||||||||||||||  | |||||||||||| |||||| || ||  ||| || ||||     U  UUCG AAC AACCAUGCUUCCUACCUUUUCUC  U CUAUCUUUUAAA AGUUAG UU CC  UUC AA UGUU     C A    A   A                       CA C            C      A  A  AA   -  -    UCAUC |
Stem-loop sequence | AAAGCCUUGCUUGGUAUGGAGGAUGGAAAAGAGUGAAGAUGGAAAAUUUAUUAAUCAAAAGGCCAAGAUUCACAAUCACUUUCCUACUUUGUAACUUAACCAUUAGAUUGACAAAUUUUCUAUCCUACCUCUUUUCCAUCCUUCGUACCAAACAAAGCUUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_012594160.1 |
|
2.5 | PREDICTED: Gossypium raimondii cysteine proteinase inhibitor 3-like (LOC105772742), transcript variant X1, mRNA | cysteine proteinase inhibitor 3-like(LOC105772742) | coding protein | psRNATarget | |||||||||
XM_012594161.1 |
|
2.5 | PREDICTED: Gossypium raimondii cysteine proteinase inhibitor 3-like (LOC105772742), transcript variant X2, mRNA | cysteine proteinase inhibitor 3-like(LOC105772742) | coding protein | psRNATarget | |||||||||
XM_012594162.1 |
|
2.5 | PREDICTED: Gossypium raimondii cysteine proteinase inhibitor 3-like (LOC105772742), transcript variant X3, mRNA | cysteine proteinase inhibitor 3-like(LOC105772742) | coding protein | psRNATarget | |||||||||
XM_012594165.1 |
|
2.5 | PREDICTED: Gossypium raimondii cysteine proteinase inhibitor 3-like (LOC105772742), transcript variant X5, mRNA | cysteine proteinase inhibitor 3-like(LOC105772742) | coding protein | psRNATarget | |||||||||
XM_012594166.1 |
|
2.5 | PREDICTED: Gossypium raimondii cysteine proteinase inhibitor 3-like (LOC105772742), transcript variant X6, mRNA | cysteine proteinase inhibitor 3-like(LOC105772742) | coding protein | psRNATarget |
1 | PMID:24044642
"Genome-wide analysis of small RNAs reveals eight fiber elongation-related and 257 novel microRNAs in elongating cotton fiber cells"; Xue W, Wang Z, Du M, Liu Y, Liu JY; BMC Genomics. 14:629(2013). |