ncRNA ID | gra-miR8774 |
Species | Gossypium raimondii |
Class | miRNA |
Genome position | chr5:54903390-54903530 [+] |
Reference genome | Graimondii2_0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 11 - UUGGAUUUUGAUUCAUAGAUUCGU - 34 |
Stem-loop(if miRNA) |
ACAAAACUG        U     --        C    UGUUCAAAC     UU  AAUUAUAUUUAAUUUGGU          UUUGGAUU UGAUU  CAUAGAUU GUGA         UAUCA  UU                  G          |||||||| |||||  |||||||| ||||         |||||  ||                  A          GAACCUAA AUUAA  GUGUUUAA UAUU         UGAAA  AU                  A AUAAAAAUU        U     AU        U    ------UAU     --  UAUUGCAUUAUUUUUAUU |
Stem-loop sequence | ACAAAACUGUUUGGAUUUUGAUUCAUAGAUUCGUGAUGUUCAAACUAUCAUUUUAAUUAUAUUUAAUUUGGUGAAUUAUUUUUAUUACGUUAUUAAAAGUUAUUUAUUAAUUUGUGUAAAUUAUAAUCCAAGUUAAAAAUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_012589354.1 |
|
2.5 | PREDICTED: Gossypium raimondii UDP-glycosyltransferase 87A1-like (LOC105769012), mRNA | UDP-glycosyltransferase 87A1-like(LOC105769012) | coding protein | psRNATarget |
1 | PMID:24044642
"Genome-wide analysis of small RNAs reveals eight fiber elongation-related and 257 novel microRNAs in elongating cotton fiber cells"; Xue W, Wang Z, Du M, Liu Y, Liu JY; BMC Genomics. 14:629(2013). |