ncRNA ID | gra-miR7486d |
Species | Gossypium raimondii |
Class | miRNA |
Genome position | chr5:7167352-7167453 [-] |
Reference genome | Graimondii2_0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 72 - UGGGGGCGCGCUUUGCUUACG - 92 |
Stem-loop(if miRNA) |
AAC                             C A  -C        -  U    GCGUCCCUGGGGGCGCGCUUUGCUUACGU G CA  AAAGCGCG CU A    ||||||||||||||||||||||||||||| | ||  |||||||| || C    CGCAGGGAUCCCCGCGCGAAACGGAUGCA C GU  UUUCGCGC GG G UUA                             C -  CU        A  A |
Stem-loop sequence | AACGCGUCCCUGGGGGCGCGCUUUGCUUACGUCGACACAAAGCGCGCUUACGAGGACGCGCUUUUCUGCCACGUAGGCAAAGCGCGCCCCUAGGGACGCAUU |
1 | PMID:24044642
"Genome-wide analysis of small RNAs reveals eight fiber elongation-related and 257 novel microRNAs in elongating cotton fiber cells"; Xue W, Wang Z, Du M, Liu Y, Liu JY; BMC Genomics. 14:629(2013). |