ncRNA ID | gra-miR7486f |
Species | Gossypium raimondii |
Class | miRNA |
Genome position | chr13:8363683-8363769 [+] |
Reference genome | Graimondii2_0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 11 - CGCUUUGCUGACGUGGAAACAAAU - 34 |
Stem-loop(if miRNA) |
-      A                   A         C  CCU  CACGUC GCGCGCUUUGCUGACGUGG AACAAAUCG GU   C  |||||| ||||||||||||||||||| ||||||||| ||  GUGCAG CGCGCGAAACGACUGUACC UUGUUUAGC CG   U G      A                   G         U  AAG |
Stem-loop sequence | CACGUCAGCGCGCUUUGCUGACGUGGAAACAAAUCGCGUCCUCUGAAGCUCGAUUUGUUGCCAUGUCAGCAAAGCGCGCAGACGUGG |
1 | PMID:24044642
"Genome-wide analysis of small RNAs reveals eight fiber elongation-related and 257 novel microRNAs in elongating cotton fiber cells"; Xue W, Wang Z, Du M, Liu Y, Liu JY; BMC Genomics. 14:629(2013). |