ncRNA ID | gra-miR7504l |
Species | Gossypium raimondii |
Class | miRNA |
Genome position | chr1:40460049-40460122 [-] |
Reference genome | Graimondii2_0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 41 - UUUCUCCUGAUUUUUAGCAUUUUU - 64 |
Stem-loop(if miRNA) |
-     U                      A     A  AAUCA AUUUUUUCUCCUGAUUUUUAGC UUUUU G  ||||| |||||||||||||||||||||| ||||| A  UUAGU UAAAAAGGAGGAUUAAAAAUCG AAAAG A U     U                      A     G |
Stem-loop sequence | AAUCAUAUUUUUUCUCCUGAUUUUUAGCAUUUUUAGAAGGAAAAAGCUAAAAAUUAGGAGGAAAAAUUUGAUUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_012631475.1 |
|
1.5 | PREDICTED: Gossypium raimondii UV radiation resistance-associated gene protein-like (LOC105800377), transcript variant X1, mRNA | UV radiation resistance-associated gene protein-like(LOC105800377) | coding protein | psRNATarget |
1 | PMID:24044642
"Genome-wide analysis of small RNAs reveals eight fiber elongation-related and 257 novel microRNAs in elongating cotton fiber cells"; Xue W, Wang Z, Du M, Liu Y, Liu JY; BMC Genomics. 14:629(2013). |