ncRNA ID | ath-miR396b-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr5:13611798-13611932 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 107 - GCUCAAGAAAGCUGUGGGAAA - 127 |
Stem-loop(if miRNA) |
G     AC                   A     UUUUUCAUUUCCAUUG   UUUUCUUAAACAAAAGUAA  GUCAU  UUUUCCACAGCUUUCUUGA CUUUC                UUU                   G  |||||  ||||||||||||||||||| |||||                |||                   A  CAGUA  AAAGGGUGUCGAAAGAACU GAAGG                GAA                   A A     CA                   C     ----------UUUUAC   UUAGAAUUUCAAAAAAAAG |
Stem-loop sequence | GGUCAUACUUUUCCACAGCUUUCUUGAACUUUCUUUUUCAUUUCCAUUGUUUUUUUCUUAAACAAAAGUAAGAAGAAAAAAAACUUUAAGAUUAAGCAUUUUGGAAGCUCAAGAAAGCUGUGGGAAAACAUGACA |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
3 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
4 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |