Search result

BaseInfo

ncRNA ID ath-miR396b-3p
Species Arabidopsis thaliana
Class miRNA
Genome position chr5:13611798-13611932 [+]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 107 - GCUCAAGAAAGCUGUGGGAAA - 127
Stem-loop(if miRNA) G     AC                   A     UUUUUCAUUUCCAUUG   UUUUCUUAAACAAAAGUAA
 GUCAU  UUUUCCACAGCUUUCUUGA CUUUC                UUU                   G
 |||||  ||||||||||||||||||| |||||                |||                   A
 CAGUA  AAAGGGUGUCGAAAGAACU GAAGG                GAA                   A
A     CA                   C     ----------UUUUAC   UUAGAAUUUCAAAAAAAAG
Stem-loop sequence GGUCAUACUUUUCCACAGCUUUCUUGAACUUUCUUUUUCAUUUCCAUUGUUUUUUUCUUAAACAAAAGUAAGAAGAAAAAAAACUUUAAGAUUAAGCAUUUUGGAAGCUCAAGAAAGCUGUGGGAAAACAUGACA

Reference

1 PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA";
Jones-Rhoades MW, Bartel DP;
Mol Cell. 14:787-799(2004).
2 PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets";
Wang XJ, Reyes JL, Chua NH, Gaasterland T;
Genome Biol. 5:R65(2004).
3 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
4 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).