Search result

BaseInfo

ncRNA ID	gma-miR5674a
Species	Glycine max
Class	miRNA
Genome position	chr9:37395782-37395989 [-]
Reference genome	v1.0
Source	miRBase
Length	21
Mature sequence(if miRNA)	11 - UAAUUGUGUUGUACAUUAUCA - 31
Stem-loop(if miRNA)	C    GG  -       UUU          -     -       UUAGUUGCUUCUUUCAGCUUACCAACAAUGAAGCCACACAAUCAAGAAUUACAAGUGACA  ACUU  GU UGAUGGU   CAAUACAAUU UCAUU UAAGAAG                                                            A  ||||  || |||||||   |||||||||| ||||| |||||||                                                            C  UGAG  UA ACUAUUA   GUUGUGUUAA AACUG CAAAUAC                                                            A C    AU  C       CAU          U     A       AUUUGUAUUUGAACAUACCAAAAAAAAAGGAUUUUACCAACAGUUUCCCUAAAAACAAUU
Stem-loop sequence	CACUUGGGUUGAUGGUUUUCAAUACAAUUUCAUUUAAGAAGUUAGUUGCUUCUUUCAGCUUACCAACAAUGAAGCCACACAAUCAAGAAUUACAAGUGACAACAUUAACAAAAAUCCCUUUGACAACCAUUUUAGGAAAAAAAAACCAUACAAGUUUAUGUUUACAUAAACAGUCAAUAAUUGUGUUGUACAUUAUCACAUUAGAGUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT089388.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||||||||||||||||||||| targets:373   UGAUAAUGUACAACACAAUUA   393 Target Full Sequence	0.0	Soybean clone JCVI-FLGm-1H18 unknown mRNA	NA	coding protein	psRNATarget
XM_014761712.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||||||||||| targets:752   UGGUAAUGUACAACACAAUUA   772 Target Full Sequence	1.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12775, mitochondrial-like (LOC100779660), mRNA	pentatricopeptide repeat-containing protein At1g12775, mitochondrial-like(LOC100779660)	coding protein	psRNATarget
XM_003533264.3	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||||||||||| targets:759   UGGUAAUGUACAACACAAUUA   779 Target Full Sequence	1.0	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100814966), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100814966)	coding protein	psRNATarget
XM_014761713.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=*||||||||||||||||| targets:719   UGGAAAUGUACAACACAAUUA   739 Target Full Sequence	2.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g63400-like (LOC102663951), mRNA	pentatricopeptide repeat-containing protein At1g63400-like(LOC102663951)	coding protein	psRNATarget
XM_014762233.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=*||||||||||||||||| targets:662   UGGAAAUGUACAACACAAUUA   682 Target Full Sequence	2.0	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100783968), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100783968)	coding protein	psRNATarget
XM_006587402.2	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||=|||||||| targets:622   UGGUAAUGUACAGCACAAUUA   642 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100780732), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100780732)	coding protein	psRNATarget
XM_006587401.2	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||=|||||||| targets:635   UGGUAAUGUACAGCACAAUUA   655 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100781818), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100781818)	coding protein	psRNATarget
XM_014762227.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||=|||||||| targets:707   UGGUAAUGUACAGCACAAUUA   727 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106794266), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106794266)	coding protein	psRNATarget
XM_014762225.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||=|||||||| targets:686   UGGUAAUGUACAGCACAAUUA   706 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106794619), transcript variant X2, mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106794619)	coding protein	psRNATarget
XM_014762226.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||=|||||||| targets:620   UGGUAAUGUACAGCACAAUUA   640 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106794619), transcript variant X3, mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106794619)	coding protein	psRNATarget
XM_014762224.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||=|||||||| targets:686   UGGUAAUGUACAGCACAAUUA   706 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106794619), transcript variant X1, mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106794619)	coding protein	psRNATarget
XM_003530008.3	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||=|||||||||| targets:772   UGGUAAUGUAUAACACAAUUA   792 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100820602), mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100820602)	coding protein	psRNATarget
XM_014762238.1	ncRNA:21   ACUAUUACAUGUUGUGUUAAU   1   ||=|||||||||=|||||||| targets:717   UGGUAAUGUACAGCACAAUUA   737 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106794624), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106794624)	coding protein	psRNATarget

Reference

1	PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing"; Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS; BMC Plant Biol. 11:5(2011).