| ncRNA ID | gma-miR5038a |
| Species | Glycine max |
| Class | miRNA |
| Genome position | chr9:28264376-28264526 [+] |
| Reference genome | v1.0 |
| Source | miRBase |
| Length | 21 |
| Mature sequence(if miRNA) | 61 - UGAGAAUUUGGCCUCUGUCCA - 81 |
| Stem-loop(if miRNA) |
---- C UCCAUUUUUCCCAAAUUUCAGAACUGUUUUAGGUUGAACUUCUCUAAAUUUUCUUGAGAAUUUGGCC UGGG A U |||| | GAAG A C AAAC - UGUUUAAGAGAACUCUUAAACCCGAGAUAGGUAGAGUUAAUAACCUUAAUUAUUAAUCUGUACCUGU |
| Stem-loop sequence | UGGGCAUCCAUUUUUCCCAAAUUUCAGAACUGUUUUAGGUUGAACUUCUCUAAAUUUUCUUGAGAAUUUGGCCUCUGUCCAUGUCUAAUUAUUAAUUCCAAUAAUUGAGAUGGAUAGAGCCCAAAUUCUCAAGAGAAUUUGUAGAAGCAAA |
| Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| JB170915.1 |
|
1.5 | Sequence 8579 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
| LQ242584.1 |
|
1.5 | Sequence 8579 from Patent EP2985353 | NA | coding protein | psRNATarget | |||||||||
| HI410454.1 |
|
1.5 | Sequence 8579 from Patent EP2074227 | NA | coding protein | psRNATarget | |||||||||
| XM_014766378.1 |
|
2.0 | PREDICTED: Glycine max transcriptional adapter ADA2a-like (LOC100779424), transcript variant X6, mRNA | transcriptional adapter ADA2a-like(LOC100779424) | coding protein | psRNATarget | |||||||||
| XM_006593799.2 |
|
2.0 | PREDICTED: Glycine max transcriptional adapter ADA2a-like (LOC100779424), transcript variant X5, mRNA | transcriptional adapter ADA2a-like(LOC100779424) | coding protein | psRNATarget | |||||||||
| XM_014766377.1 |
|
2.0 | PREDICTED: Glycine max transcriptional adapter ADA2a-like (LOC100779424), transcript variant X3, mRNA | transcriptional adapter ADA2a-like(LOC100779424) | coding protein | psRNATarget | |||||||||
| XM_014766376.1 |
|
2.0 | PREDICTED: Glycine max transcriptional adapter ADA2a-like (LOC100779424), transcript variant X2, mRNA | transcriptional adapter ADA2a-like(LOC100779424) | coding protein | psRNATarget | |||||||||
| XM_014766375.1 |
|
2.0 | PREDICTED: Glycine max transcriptional adapter ADA2a-like (LOC100779424), transcript variant X1, mRNA | transcriptional adapter ADA2a-like(LOC100779424) | coding protein | psRNATarget | |||||||||
| XM_006593796.2 |
|
2.0 | PREDICTED: Glycine max transcriptional adapter ADA2a-like (LOC100779424), transcript variant X4, mRNA | transcriptional adapter ADA2a-like(LOC100779424) | coding protein | psRNATarget | |||||||||
| XM_006587195.2 |
|
2.5 | PREDICTED: Glycine max uncharacterized LOC102669160 (LOC102669160), mRNA | uncharacterized LOC102669160(LOC102669160) | coding protein | psRNATarget |
| 1 | PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"; Radwan O, Liu Y, Clough SJ; Mol Plant Microbe Interact. 24:958-972(2011). |
| 2 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
| 3 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |