ncRNA ID | gma-miR1507c-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr9:16565933-16566022 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 10 - CCUCAUUCCAAACAUCAUCU - 29 |
Stem-loop(if miRNA) |
-----  C    -               A   U   AUU       A      UG UAGA GGUGUUUGGGAUGAG GAA AGA   UUUUCAA U      || |||| ||||||||||||||| ||| |||   |||||||      AC AUCU CUACAAACCUUACUC CUU UCU   GAAAGUU G UACAC  A    A               C   C   AGU       C |
Stem-loop sequence | UGCUAGAGGUGUUUGGGAUGAGAGAAUAGAAUUUUUUCAAAUGCUUGAAAGUGAUCUCUUCCCUCAUUCCAAACAUCAUCUAACACACAU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_006578431.2 |
|
1.5 | PREDICTED: Glycine max putative disease resistance protein RGA4 (LOC100781872), transcript variant X1, mRNA | putative disease resistance protein RGA4(LOC100781872) | coding protein | psRNATarget | |||||||||
XM_014774671.1 |
|
1.5 | PREDICTED: Glycine max putative disease resistance protein RGA4 (LOC100781872), transcript variant X4, mRNA | putative disease resistance protein RGA4(LOC100781872) | coding protein | psRNATarget | |||||||||
XM_014774670.1 |
|
1.5 | PREDICTED: Glycine max putative disease resistance protein RGA4 (LOC100781872), transcript variant X3, mRNA | putative disease resistance protein RGA4(LOC100781872) | coding protein | psRNATarget | |||||||||
XM_014767520.1 |
|
1.5 | PREDICTED: Glycine max putative disease resistance protein At3g14460 (LOC100789590), mRNA | putative disease resistance protein At3g14460(LOC100789590) | coding protein | psRNATarget | |||||||||
XM_006578432.2 |
|
1.5 | PREDICTED: Glycine max putative disease resistance protein RGA4 (LOC100781872), transcript variant X5, mRNA | putative disease resistance protein RGA4(LOC100781872) | coding protein | psRNATarget | |||||||||
XM_014774668.1 |
|
1.5 | PREDICTED: Glycine max putative disease resistance protein RGA4 (LOC100781872), transcript variant X2, mRNA | putative disease resistance protein RGA4(LOC100781872) | coding protein | psRNATarget | |||||||||
XM_006598398.2 |
|
2.0 | PREDICTED: Glycine max serine/threonine-protein phosphatase 7 long form homolog (LOC102667206), mRNA | serine/threonine-protein phosphatase 7 long form homolog(LOC102667206) | coding protein | psRNATarget | |||||||||
XM_006591559.1 |
|
2.5 | PREDICTED: Glycine max putative disease resistance RPP13-like protein 1 (LOC100788285), mRNA | putative disease resistance RPP13-like protein 1(LOC100788285) | coding protein | psRNATarget | |||||||||
XM_014764056.1 |
|
2.5 | PREDICTED: Glycine max putative disease resistance RPP13-like protein 1 (LOC106795179), mRNA | putative disease resistance RPP13-like protein 1(LOC106795179) | coding protein | psRNATarget | |||||||||
XM_006591252.2 |
|
2.5 | PREDICTED: Glycine max disease resistance protein RGA2-like (LOC100810734), mRNA | disease resistance protein RGA2-like(LOC100810734) | coding protein | psRNATarget | |||||||||
XM_014768810.1 |
|
2.5 | PREDICTED: Glycine max vacuolar protein sorting-associated protein 8 homolog (LOC100785710), mRNA | vacuolar protein sorting-associated protein 8 homolog(LOC100785710) | coding protein | psRNATarget |
1 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |
2 | PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"; Radwan O, Liu Y, Clough SJ; Mol Plant Microbe Interact. 24:958-972(2011). |
3 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
4 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |
5 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |