Search result

BaseInfo

ncRNA ID gma-miR1507c-5p
Species Glycine max
Class miRNA
Genome position chr9:16565933-16566022 [-]
Reference genome v1.0
Source miRBase
Length 21
Mature sequence(if miRNA) 65 - GAGGUGUUUGGGAUGAGAGAA - 85
Stem-loop(if miRNA) -----  C    -               A   U   AUU       A
     UG UAGA GGUGUUUGGGAUGAG GAA AGA   UUUUCAA U
     || |||| ||||||||||||||| ||| |||   |||||||
     AC AUCU CUACAAACCUUACUC CUU UCU   GAAAGUU G
UACAC  A    A               C   C   AGU       C
Stem-loop sequence UGCUAGAGGUGUUUGGGAUGAGAGAAUAGAAUUUUUUCAAAUGCUUGAAAGUGAUCUCUUCCCUCAUUCCAAACAUCAUCUAACACACAU

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
XM_014764352.1
ncRNA:21   AAGAGAGUAGGGUUUGUGGAG   1
  |||||||*|||||||||||*|
targets:164   UUCUCUCUUCCCAAACACCGC   184

2.5 PREDICTED: Glycine max TPR-containing protein kinase (LOC732542), transcript variant X1, mRNA TPR-containing protein kinase(LOC732542) coding protein psRNATarget
BT095140.1
ncRNA:21   AAGAGAGUAGGGUUUGUGGAG   1
  |*|||||||||||||||*||*
targets:89   UCCUCUCAUCCCAAACAGCUG   109

2.5 Soybean clone JCVI-FLGm-6F24 unknown mRNA NA coding protein psRNATarget

Reference

1 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
2 PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome";
Radwan O, Liu Y, Clough SJ;
Mol Plant Microbe Interact. 24:958-972(2011).
3 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).
4 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).
5 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).